EU/3/03/160

  • Email
  • Help

Orphan designation

Key facts

Product details for <p>Antisense oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT)</p>
Active substanceAntisense oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT)
Medicine Name
Disease/conditionTreatment of retinopathy of prematurity
Date of decision02/10/2003
OutcomePositive
Orphan decision numberEU/3/03/160

Review of designation

Sponsor's contact details

Gene Signal SAS
France

Patients' organisations

For contact details of patients’ organisations whose activities are targeted at rare diseases, see:

  • Orphanet, a database containing information on rare diseases which includes a directory of patients’ organisations registered in Europe.
  • European Organisation for Rare Diseases (EURORDIS), a non-governmental alliance of patient organisations and individuals active in the field of rare diseases.