EU/3/03/161: Orphan designation for the treatment of neovascular glaucoma

Antisense oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT)

Table of contents

Overview

On 2 October 2013, orphan designation (EU/3/03/131) was granted by the European Commission to Gene Signal SAS, France, for antisense oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) for the treamtne of neovascular glaucoma.

Key facts

Active substance
Antisense oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT)
Intended use
Treatment of neovascular glaucoma
Orphan designation status
Positive
EU designation number
EU/3/03/161
Date of designation
02/10/2003
Sponsor
Gene Signal SAS
France

Documents related to this orphan designation evaluation

Patients' organisations

For contact details of patients’ organisations whose activities are targeted at rare diseases, see:

  • Orphanet, a database containing information on rare diseases, which includes a directory of patients’ organisations registered in Europe.

  • European Organisation for Rare Diseases (EURORDIS), a non-governmental alliance of patient organisations and individuals active in the field of rare diseases.

EU register of orphan medicines

The list of medicines that have received an orphan designation in the EU is available on the European Commission's website:

How useful was this page?

Add your rating