EU/3/03/161

Table of contents

About

On 2 October 2013, orphan designation (EU/3/03/131) was granted by the European Commission to Gene Signal SAS, France, for antisense oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) for the treamtne of neovascular glaucoma.

Key facts

Active substance
Antisense oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT)
Disease / condition
Treatment of neovascular glaucoma
Date of decision
02/10/2003
Outcome
Positive
Orphan decision number
EU/3/03/161

Sponsor's contact details

Gene Signal SAS
France

Patients' organisations

For contact details of patients’ organisations whose activities are targeted at rare diseases, see:

  • Orphanet, a database containing information on rare diseases, which includes a directory of patients’ organisations registered in Europe;
  • European Organisation for Rare Diseases (EURORDIS), a non-governmental alliance of patient organisations and individuals active in the field of rare diseases.

How useful was this page?

Add your rating