EU/3/07/445

Table of contents

About

On 17 April 2007, orphan designation (EU/3/07/445) was granted by the European Commission to Gene Signal SAS, France, for antisense oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) for the prevention of corneal graft rejection.

Key facts

Active substance
Antisense oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT)
Disease / condition
Prevention of corneal graft rejection
Date of decision
17/04/2007
Outcome
Positive
Orphan decision number
EU/3/07/445

Sponsor's contact details

Gene Signal SAS
4, rue Pierre Fontaine
91000 Evry
France
Telephone: + 33 1 55 60 12 55
Telefax: + 33 1 55 60 12 56
E-mail: salman.almahmood@wanadoo.fr

Patients' organisations

For contact details of patients’ organisations whose activities are targeted at rare diseases, see:

  • The Eyecare Trust
    PO Box 804
    Aylesbury
    Buckinghamshire HP20 9DF
    United Kingdom
    Telephone: +44 845 129 5001
    Telefax: +44 845 129 5001
    E-mail: info@eyecaretrust.org.uk
  • KERATOS: Association sur les Pathologies de la Surface Oculaire et les Dysfonctionnements Lacrymaux
    55 avenue de la République
    93170 Bagnolet
    France
    Telephone: +33 9 54 09 76 88
    E-mail: keratos_contact@hotmail.com
  • KÓROS : Associazione per la Ricerca e la Prevenzione delle Malattie Oculari Infantili - ONLUS
    Viale Amerigo Vespucci 1/C
    30173 Mestre (VE)
    Italy
    Telephone: +39 041 26 68 784
    Telefax: + 39 041 53 51 831
    E-mail: segreteria@korosonlus.org

How useful was this page?

Add your rating