EU/3/05/327 - orphan designation for treatment of glioma

oligonucleotide phosphorothioate (TAAACGTTATAACGTTATGACGTCAT), sodium salt
OrphanHuman

Czech is available via eTranslation, the European Commission's machine translation service.

Translate to Czech | Important information about machine translation

Overview

On 28 October 2005, orphan designation (EU/3/05/327) was granted by the European Commission to Oligovax, France, for oligonucleotide phosphorothioate (TAAACGTTATAACGTT ATGACGTCAT), sodium salt for the treatment of glioma.

Tumours that begin in brain tissue are known as primary brain tumours. Primary brain tumours are classified by the type of tissue from which they originate, the most common being gliomas, which begin in the glial (supportive) tissue. Gliomas represent a potentially debilitating and life-threatening condition. Patients affected by gliomas can suffer from severe symptoms of the nervous system, depending on where in the brain the tumour develops.

Treatment for gliomas depends on a number of factors and encompasses several methods such as surgery, radiotherapy (using high-dose x-rays or other high energy rays to kill cancer cells) or chemotherapy (using drugs to kill cancer cells), as well as some symptomatic treatments. Symptomatic treatments include certain steroid hormones (corticosteroids) to control the effects of raised pressure within the skull, and medication to help control seizures, as required. Methods of treatment of glioma were authorised in the Community at the time of submission of the application for orphan designation. Oligonucleotide phosphorothioate (TAAACGTTATAACGTT ATGACGTCAT), sodium salt might be of potential significant benefit for the treatment of gliomas because it might act in a different way and thereby it might improve the long-term outcome of the patients. The assumption will have to be confirmed at the time of marketing authorisation. This will be necessary to maintain the orphan status.

According to the information provided by the sponsor, glioma was considered to affect about 46,000 persons in the European Union.

*Disclaimer: For the purpose of the designation, the number of patients affected by the condition is estimated and assessed based on data from the European Union (EU 25), Norway, Iceland and Lichtenstein. This represents a population of 459,700,000 (Eurostat 2004). This estimate is based on available information and calculations presented by the sponsor at the time of the application.

The proposed oligonucleotide phosphorothioate is a synthetic compound designed to mimic certain parts of the fundamental genetic material of the bacterial cell (bacterial DNA or CpGoligodeoxynucleotide). Once administered directly into the brain tumour, the product is expected to stimulate the body's defence system (immune system) in the tumour area. This would then start-up a cascade of molecular reactions against the glioma and that could eventually kill the glioma cells.

The effects of oligonucleotide phosphorothioate (TAAACGTTATAACGTT ATGACGTCAT), sodium salt were evaluated in experimental models.
At the time of submission of the application for orphan designation, clinical trials in patients with
glioma were ongoing.
Oligonucleotide phosphorothioate (TAAACGTTATAACGTT ATGACGTCAT), sodium salt was not authorised anywhere worldwide for glioma or designated as orphan medicinal product elsewhere for this condition, at the time of submission.
According to Regulation (EC) No 141/2000 of 16 December 1999, the Committee for Orphan Medicinal Products (COMP) adopted on 9 September 2005 a positive opinion recommending the grant of the above-mentioned designation.

  • the seriousness of the condition,
  • the existence or not of alternative methods of diagnosis, prevention or treatment and
  • either the rarity of the condition (considered to affect not more than five in ten thousand persons in the Community) or the insufficient return of development investments.

Designated orphan medicinal products are still investigational products which were considered for designation on the basis of potential activity. An orphan designation is not a marketing authorisation. As a consequence, demonstration of the quality, safety and efficacy will be necessary before this product can be granted a marketing authorisation.

Key facts

Active substance
oligonucleotide phosphorothioate (TAAACGTTATAACGTTATGACGTCAT), sodium salt
Intended use
Treatment of glioma
Orphan designation status
Positive
EU designation number
EU/3/05/327
Date of designation
Sponsor

Oligovax
Hôpital Broussais
c/o Laboratoire d’EGPC
96 rue Didot
75014 Paris
France
Telephone: +33 1 45 88 85 01
Telefax: +33 1 45 88 85 00
E-mail: contact@oligovax.com

EMA list of opinions on orphan medicinal product designation

EMA publishes information on orphan medicinal product designation adopted by the Committee for Orphan Medicinal Products (COMP) on the IRIS online platform:

EU register of orphan medicines

The list of medicines that have received an orphan designation in the EU is available on the European Commission's website:

Share this page