EU/3/07/445 - orphan designation for prevention of corneal graft rejection

antisense oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT)
OrphanHuman

Spanish is available via eTranslation, the European Commission's machine translation service.

Translate to Spanish | Important information about machine translation

Overview

On 17 April 2007, orphan designation (EU/3/07/445) was granted by the European Commission to Gene Signal SAS, France, for antisense oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) for the prevention of corneal graft rejection.

After transplantation of the cornea (the round transparent part of the eye, external to the iris), there is a risk that the transplant (graft) will not be accepted by the patient's immune system, which would lead to a phenomenon called “rejection”.
The cornea does not have blood vessels, so it is usually difficult for white blood cells and antibodies (both mediators of rejection) to reach it and activate rejection mechanisms. For this reason, rejection tends to occur less frequently in corneal transplants compared to other organs that do have blood vessels, such as the kidney, but it is still a feared complication as it can lead to loss of vision in the affected eye.
In some eye diseases, however, there can be formation of new blood vessels in the cornea, and this also may occur (or worsen) in the new transplanted cornea, thus allowing easier access for white blood cells and antibiotics, and an increased likelihood of rejection.

Currently, no satisfactory methods exist in the European Union that were authorised at the time of application, for the prevention of corneal graft rejection. However, eye drops containing corticosteroids (cortisone-like substances) are commonly prescribed after corneal transplantation to prevent rejection; other drugs that have been employed are cyclosporin and tacrolimus, both for the treatment and the prevention of corneal graft rejection.

According to the information provided by the sponsor, the population of patients eligible for prevention of corneal graft rejection was estimated to be approximately 46,000 persons in the European Union.

* Disclaimer: For the purpose of the designation, the number of patients affected by the condition is estimated and assessed based on data from the European Union (EU 25), Norway, Iceland and Lichtenstein. This represents a population of 459,700,000 (Eurostat 2004). This estimate is based on available information and calculations presented by the sponsor at the time of the application.

Antisense oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) acts by blocking the production of a protein that is required for the formation and growth of new blood vessels. It does not act on already existing blood vessels. Since formation of new blood vessels in the cornea is believed to be one of the principal mechanisms by which the immune system may reject a corneal transplantation, the medicinal product is expected to reduce the likelihood of rejection itself.

The effects of antisense oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) were evaluated in experimental models. At the time of submission of the application for orphan designation, no clinical trials in patients with corneal transplants were initiated.
Antisense oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) was not authorised anywhere worldwide for the prevention of Corneal Graft Rejection, at the time of submission.

According to Regulation (EC) No 141/2000 of 16 December 1999, the Committee for Orphan Medicinal Products (COMP) adopted on 8 March 2007 a positive opinion recommending the grant of the above-mentioned designation.

  • the seriousness of the condition,
  • the existence or not of alternative methods of diagnosis, prevention or treatment and
  • either the rarity of the condition (considered to affect not more than five in ten thousand persons in the Community) or the insufficient return of development investments.

Designated orphan medicinal products are still investigational products which were considered for designation on the basis of potential activity. An orphan designation is not a marketing authorisation. As a consequence, demonstration of the quality, safety and efficacy will be necessary before this product can be granted a marketing authorisation.

Key facts

Active substance
antisense oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT)
Intended use
Prevention of corneal graft rejection
Orphan designation status
Positive
EU designation number
EU/3/07/445
Date of designation
Sponsor

Gene Signal SAS
4, rue Pierre Fontaine
91000 Evry
France
Telephone: + 33 1 55 60 12 55
Telefax: + 33 1 55 60 12 56
E-mail: salman.almahmood@wanadoo.fr

EMA list of opinions on orphan medicinal product designation

EMA publishes information on orphan medicinal product designation adopted by the Committee for Orphan Medicinal Products (COMP) on the IRIS online platform:

EU register of orphan medicines

The list of medicines that have received an orphan designation in the EU is available on the European Commission's website:

Share this page