EU/3/07/445

Table of contents

About

On 17 April 2007, orphan designation (EU/3/07/445) was granted by the European Commission to Gene Signal SAS, France, for antisense oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) for the prevention of corneal graft rejection.

Key facts

Active substance
Antisense oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT)
Disease / condition
Prevention of corneal graft rejection
Date of first decision
17/04/2007
Outcome
Positive
EU designation number
EU/3/07/445

Sponsor's contact details

Gene Signal SAS
4, rue Pierre Fontaine
91000 Evry
France
Telephone: + 33 1 55 60 12 55
Telefax: + 33 1 55 60 12 56
E-mail: salman.almahmood@wanadoo.fr

Patients' organisations

For contact details of patients’ organisations whose activities are targeted at rare diseases, see:

How useful was this page?

Add your rating