EU/3/03/160 - orphan designation for treatment of retinopathy of prematurity

Overview

EU/3/03/160: Public summary of positive opinion for orphan designation of antisense oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) for the treatment of retinopathy of prematurity

AdoptedReference Number: EMEA/COMP/1440/03

English (EN) (142.88 KB - PDF)

First published: 26/04/2004Last updated: 26/04/2004

View

Key facts

Active substance: Antisense oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT)
Intended use: Treatment of retinopathy of prematurity
Orphan designation status: Positive
EU designation number: EU/3/03/160
Date of designation: 02/10/2003
Sponsor: Gene Signal SAS
France

EMA list of opinions on orphan medicinal product designation

EMA publishes information on orphan medicinal product designation adopted by the Committee for Orphan Medicinal Products (COMP) on the IRIS online platform:

List of opinions on orphan medicinal product designation

Patients' organisations

For contact details of patients’ organisations whose activities are targeted at rare diseases, see:

Orphanet, a database containing information on rare diseases, which includes a directory of patients’ organisations registered in Europe.
European Organisation for Rare Diseases (EURORDIS), a non-governmental alliance of patient organisations and individuals active in the field of rare diseases.

EU register of orphan medicines

The list of medicines that have received an orphan designation in the EU is available on the European Commission's website:

European Commission: Community Register of orphan medicinal products