EU/3/03/160: Orphan designation for the treatment of retinopathy of prematurity
Antisense oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT)
Table of contents
Key facts
| Active substance |
Antisense oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT)
|
| Intended use |
Treatment of retinopathy of prematurity
|
| Orphan designation status |
Positive
|
| EU designation number |
EU/3/03/160
|
| Date of designation |
02/10/2003
|
| Sponsor |
Gene Signal SAS
France |
Patients' organisations
For contact details of patients’ organisations whose activities are targeted at rare diseases, see:
Orphanet, a database containing information on rare diseases, which includes a directory of patients’ organisations registered in Europe.
European Organisation for Rare Diseases (EURORDIS), a non-governmental alliance of patient organisations and individuals active in the field of rare diseases.
EU register of orphan medicines
The list of medicines that have received an orphan designation in the EU is available on the European Commission's website: